Screening and identification of hub genes related to oxidative stress in ulcerative colitis based on bioinformatics analysis

doi:10.3877/cma.j.issn.2095-8765.2026.01.003

Abstract

Abstract:

Objective

To screen and identify key genes associated with oxidative stress in ulcerative colitis.

Methods

The GSE179285 gene expression profiles were acquired from the gene expression omnibus database. And GEO2R was used to identify differentially expressed genes. We intersected the differentially expressed genes with the oxidative stress-related genes screened in the GeneCard database to find the oxidative stress-related genes in ulcerative colitis. R software was used to conduct gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses of differentially expressed genes. Module of PPI network and analysis of key genes using Cytoscape software. colon mucosal Tissue samples from 30 patients with active ulcerative colitis and healthy control subjects were collected, the expression of Hub genes was verified using quantitative real-time polymerase chain reaction (qPCR).

Results

We identified 95 differentially expressed genes in response to oxidative stress. Five key genes—CD44,CXCL8,hypoxia inducible factor 1 subunit alpha (HIF1α),interleukin-1 beta (IL1β) and angiotensinogen (AGT)—were selected as a result.qPCR analysis revealed that compared with the control group, the mRNA expression of CD44, CXCL8, HIF1α, and IL1β was elevated in the ulcerative colitis group (P<0.0001). There was no significant difference in AGT expression between the two groups (P>0.05).

Conclusion

CD44, CXCL8, HIF1α, and IL1β play critical roles in ulcerative colitis and could serve as potential diagnostic and therapeutic targets for the disease.

Key words: Bioinformatics analysis, Ulcerative colitis, Oxidative stress, Key differentially expressed genes

Huan He, Guangxin Xu, Zhiyi Han, Tong Cui. Screening and identification of hub genes related to oxidative stress in ulcerative colitis based on bioinformatics analysis[J]. Chinese Journal of Gastroesophageal Reflux Disease(Electronic Edition), 2026, 13(01): 16-24.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhwsgflbdzzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.2095-8765.2026.01.003

https://zhwsgflbdzzz.cma-cmc.com.cn/EN/Y2026/V13/I01/16

Figures/Tables 8

References 52

1	Voelker R. What is ulcerative colitis?[J]. JAMA, 2024, 331(8):716.
2	Hodson R. Inflammatory bowel disease[J]. Nature, 2016, 540(7634): S97.
3	Martemucci G, Costagliola C, Mariano M, et al. Free radical properties, source and targets[J]. Antioxid Consumption Health Oxygen, 2022, 2(2): 48-78.
4	Juan CA, Pérez de la Lastra JM, Plou FJ, et al.The chemistry of reactive oxygen species (ROS) revisited: outlining their role in biological macromolecules (DNA, lipids and proteins) and induced pathologies[J]. Int J Mol Sci, 2021, 22(9):4642.
5	Nakase H, Sato N, Mizuno N, et al. The influence of cytokines on the complex pathology of ulcerative colitis[J]. Autoimmun Rev, 2022, 21(3): 103017.
6	Sies H, Jones DP. Reactive oxygen species (ROS) as pleiotropic physiological signalling agents[J]. Nat Rev Mol Cell Biol, 2020, 21(7): 363-383.
7	Kushkevych I, Martinkova K, Vitezova M, et al. Intestinal microbiota and perspectives of the use of meta-analysis for comparison of ulcerative colitis studies [J]. J Clin Med, 2021, 10(3): 462.
8	Carini F, Mazzola M, Rappa F, et al. Colorectal carcinogenesis: role of oxidative stress and antioxidants[J]. Anticancer Res, 2017, 37(9): 4759-4766．
9	Tian T, Wang Z, Zhang J. Pathomechanisms of oxidative stress in inflammatory bowel disease and potential antioxidant therapies[J].Oxid Med Cell Longev, 2017, 2017: 4535194.
10	Reynolds JM, Angkasekwinai P, Dong C.IL-17 family member cytokines: regulation and function in innate immunity[J]. Cytokine Growth Factor Rev, 2010, 21(6): 413-423.
11	Arisawa T, Tahara T, Shibata T, et al. The influence of polymorphisms of interleukin-17A and interleukin-17F genes on the susceptibility to ulcerative colitis[J]. J Clin Immunol, 2008, 28(1): 44-49.
12	Kim SW, Kim ES, Moon CM, et al. Genetic polymorphisms of IL-23R and IL-17A and novel insights into their associations with inflammatory bowel disease[J]. Gut, 2011, 60(11): 1527-1536.
13	Cua DJ, Tato CM. Innate IL-17-producing cells: the sentinels of the immune system[J]. Nat Rev Immunol, 2010, 10(7): 479-489.
14	Ohman L, Dahlén R, Isaksson S, et al. Serum IL-17A in newly diagnosed treatment-naive patients with ulcerative colitis reflects clinical disease severity and predicts the course of diseas[J]. Inflamm Bowel Dis, 2013, 19(11): 2433-2439.
15	Ajdukovi J, Tonki A, Salamuni I, et al. Interleukins IL-33 and IL-17/IL-17A in patients with ulcerative colitis[J].Hepatogastroenterology，2010, 57(104):1442-1444.
16	Yu P, Shen F, Zhang X, et al. Association of single nucleotide polymorphisms of IL23R and IL17 with ulcerative colitis risk in a Chinese Han population[J].PLoS One，2012,7(9):e44380.
17	Hyun YS, Han DS, Lee AR,et al. Role of IL-17A in the development of colitis-associated cancer[J].Carcinogenesis，2012，33(4):931-936.
18	Bingham CO. The pathogenesis of rheumatoid arthritis: pivotal cytokines involved in bone degradation and inflammation[J]. J Rheumatol Suppl, 2002, 65:3-9.
19	Ljung T, Herulf M, Beijer E, et al. Rectal nitric oxide assessment in children with Crohn disease and ulcerative colitis. Indicator of ileocaecal and colorectal affection[J]. Scand J Gastroenterol, 2001, 36(10): 1073-1076.
20	Guihot G, Guimbaud R, Bertrand V, et al. Inducible nitric oxide synthase activity in colon biopsies from inflammatory areas: correlation with inflammation intensity in patients with ulcerative colitis but not with Crohn’s disease[J].Amino Acids, 2000, 18(3): 229-237.
21	Perner A, Andresen L, Normark M, et al. Expression of nitric oxide synthases and effects of L-arginine and L-NMMA on nitric oxide production and fluid transport in collagenous colitis[J]. Gut，2001, 49(3): 387-394.
22	Dijkstra G, Zandvoort AJ, Kobold AC, et al. Increased expression of inducible nitric oxide synthase in circulating monocytes from patients with active inflammatory bowel disease[J].Scand J Gastroenterol, 2002, (5): 546–554.
23	Colón AL, Menchén LA, Hurtado O, et al. Implication of TNF-alpha convertase (TACE/ADAM17) in inducible nitric oxide synthase expression and inflammation in an experimental model of colitis[J].Cytokine, 2001, 16(6): 220-226.
24	张可,邓长生,朱尤庆,等. 核因子-κB、环氧化酶-2和诱导型一氧化氮合酶在溃疡性结肠炎组织中的表达意义[J]. 世界华人消化杂志, 2002, 10(5):575-578.
25	Goodstone NJ, Hardingham TE.Tumour necrosis factor alpha stimulates nitric oxide production more potently than interleukin-1beta in porcine articular chondrocytes[J]. Rheumatology(Oxford), 2002, 41(8): 883-891.
26	Hoffmann U, Heilmann K, Hayford C, et al. CD44v7 ligation downregulates the inflammatory immune response in Crohn’s disease patients by apoptosis induction in mononuclear cells from the lamina propria[J]. Cell Death Differ, 2007, 14(8): 1542-1551．
27	Brazil JC, Lee WY, Kolegraff KN, et al. Neutrophil migration across intestinal epithelium: evidence for a role of CD44 in regulating detachment of migrating cells from the luminal surface[J]. J Immunol, 2010, 185(11):7026-7036.
28	Song X. Efcient therapy of infammatory bowel disease (IBD) with highly specifc and durable targeted Ta(2)C modifed with chondroitin sulfate (TACS)[J]. Adv Mater, 2023, 35(36): e2301585.
29	Franić I. Expression of CD44 in leukocyte subpopulations in patients with infammatory bowel diseases[J]. Diagnostics (Basel)，2014, 12(8):2022.
30	Chuntharapai A, Kim KJ. Regulation of the expression of IL-8 receptor A/B by IL-8: possible functions of each receptor[J].J Immunol, 1995,155(5):2587-2594.
31	Hartl D, Latzin P, Hordijk P, et al. Cleavage of CXCR1 on neutrophils disables bacterial killing in cystic fibrosis lung disease[J]. Nat Med, 2007, 13(12): 1423-1430.
32	Samie A, Dzhivhuho GA, Nangammbi TC. Distribution of CXCR2 +1208 T/C gene polymorphisms in relation to opportunistic infections among HIV-infected patients in Limpopo Province, South Africa[J]. Genet Mol Res, 2014, 13(3): 7470-7479.
33	Craig A, Mai J, Cai S, et al.Neutrophil recruitment to the lungs during bacterial pneumonia[J]. Infect Immun, 2009, 77(2): 568-575.
34	Heidarian F, Alebouyeh M, Shahrokh S, et al. Altered fecal bacterial composition correlates with disease activity in inflammatory bowel disease and the extent of IL8 induction[J]. Curr Res Transl Med, 2019, 67(2): 41-50.
35	Cao F, Cheng YS, Yu L, et al.Bioinformatics analysis of differentially expressed genes and protein-protein raction networks associated with functional pathways in ulcerative colitis[J]. Inte Med Sci Monit, 2021, 19(27):1-11.
36	Semenza GL. Targeting HIF-1 for cancer therapy[J]. Nat Rev Cancer, 2003, 3(10): 721-732.
37	Giatromanolaki A, Sivridis E, Maltezos E, et al. Hypoxia inducible factor 1α and 2α overexpression in inflammatory bowel disease[J].J Clin Pathol, 2003, 56(3): 209-213.
38	Yin J, Ren Y, ang K, et al.The role of hypoxia-inducible factor 1-alpha in inflammatory bowel disease[J]. Cell Biol Int, 2022, 46(1): 46-51.
39	Pral LP, Fachi JL, Corrêa RO, et al. Hypoxia and HIF-1 as key regulators of gut microbiota and host interactions[J]. Trends Immunol, 2021, 42(7): 604-621.
40	Cao W, Vrees MD, Potenti FM, et al.Interleukin 1beta-induced production of H₂O₂ contributes to reduced sigmoid colonic circular smooth muscle contractility in ulcerative colitis[J]. J Pharmacol Exp Ther, 2004, 311(1): 60-70.
41	Li DF, Chang X, Zhao JL, et al.Colonic epithelial PHLPP2 deficiency promotes colonic epithelial pyroptosis by activating the NF-κB signaling pathway[J]. Oxid Med Cell Longev, 2021, 2021: 5570731.
42	Mitsialis V, Wall S, Liu P, et al.Single-cell analyses of colon and blood reveal distinct immune cell signatures of ulcerative colitis and Crohn’s disease[J].Gastroenterology, 2020,159(2):591-608.
43	Zhang B, Chen H, Ouyang J, et al. SQSTM1-dependent autophagic degradation of PKM2 inhibits the production of mature IL1B/IL-1β and contributes to LIPUS-mediated anti-inflammatory effect[J].Autophagy, 2020, 16(7): 1262-1278.
44	Bulek K, Zhao J, Liao Y, et al. Epithelial-derived gasdermin D mediates nonlytic IL-1β release during experimental colitis[J]. J Clin Invest, 2020, 130(8): 4218-4234.
45	Lippai R, Veres-Székely A, Sziksz E, et al. Immunomodulatory role of Parkinson’s disease 7 in inflammatory bowel disease[J].Sci Rep, 2021, 11(1): 14582.
46	Sendler M, van den Brandt C, Glaubitz J, et al. NLRP3 inflammasome regulates development of systemic inflammatory response and compensatory anti-inflammatory response syndromes in mice with acute pancreatitis[J]. Gastroenterology, 2020, 158(1): 253-269.
47	Rangaraju S, Dammer EB, Raza SA, et al.Identification and therapeutic modulation of a pro-inflammatory subset of disease-associated-microglia in Alzheimer’s disease[J]. Mol Neurodegener, 2018, 13(1): 24.
48	Rawat M, Nighot M, Al-Sadi R, et al. IL1B increases intestinal tight junction permeability by up-regulation of MIR200C-3p, which degrades occludin mRNA[J]. Gastroenterology, 2020, 159(4): 1375-1389.
49	Tedeschi V, Secondo A. Emerging role of lysosomal calcium store as a hub of neuroprotection[J]. Neural Regen Res, 2022, 17(6): 1259-1260.
50	Kong Y, Zhao X, Qiu M, et al. Tubular Mas receptor mediates lipid-induced kidney injury[J]. Cell Death Disease, 2021, 12(1): 110.
51	Salazar G, Cullen A, Huang J, et al. SQSTM1/p62 and PPARGC1A/PGC-1alpha at the interface of autophagy and vascular senescence[J].Autophagy, 2020, 16(6): 1092-1110.
52	Shen L, Zhang T, Lu H. Overexpression of AGT promotes bronchopulmonary dysplasis via the JAK/STAT signal pathway[J]. Oncotarget, 2017, 8(56): 9607996088.

基因	引物序列
AGT-F	TGCTACAGACGGTTGCTAAGA
AGT-R	TGTTGCTGCTGCCAAGGA
IL1β-F	TCAGCACCTCTCAAGCAGAA
IL1β-R	CACATTCAGCACAGGACTCTC
CXCL8-F	TAGGACAAGAGCCAGGAAGAA
CXCL8-R	AACGCTGTAGGTCAGAAAGATG
CD44-F	TACAGCCTCAGCAGAGCAC
CD44-R	AGCGAAGGACACACCCAAG
HIF1α-F	ACAAGCCACCTGAGGAGAG
HIF1α-R	GCGGAGAAGAGAAGGAAAGG

基因	引物序列
AGT-F	TGCTACAGACGGTTGCTAAGA
AGT-R	TGTTGCTGCTGCCAAGGA
IL1β-F	TCAGCACCTCTCAAGCAGAA
IL1β-R	CACATTCAGCACAGGACTCTC
CXCL8-F	TAGGACAAGAGCCAGGAAGAA
CXCL8-R	AACGCTGTAGGTCAGAAAGATG
CD44-F	TACAGCCTCAGCAGAGCAC
CD44-R	AGCGAAGGACACACCCAAG
HIF1α-F	ACAAGCCACCTGAGGAGAG
HIF1α-R	GCGGAGAAGAGAAGGAAAGG

[1]	Xinrui Zhu, Min Niu, Yan Du. Research progress on ulcerative colitis based on tryptophan metabolism [J]. Chinese Journal of Experimental and Clinical Infectious Diseases(Electronic Edition), 2025, 19(06): 321-326.
[2]	Qin Yin, Yuhan Yan, Wei Yao, ChengWen Xu, Xiaolong Dai, Hao Yang, ChunWei Xu, Dong Wang, Ming Yuan, ZhenYu Liu. Research on the use of rhubarb as an adjuvant therapy for multiple injuries induced acute lung injury [J]. Chinese Journal of Lung Diseases(Electronic Edition), 2026, 19(02): 247-252.
[3]	Xiaoyan Gao, Jiangyun Zhou. LncRNA PVT1 promotes H₂O₂-induced apoptosis and oxidative stress in H9C2 cardiomyocytes by targeting miR-145-5p [J]. Chinese Journal of Cell and Stem Cell(Electronic Edition), 2025, 15(06): 346-353.
[4]	Haobo Zhang, Jianxiang Niu. Research progress in NLRP3 inflammosome in non-alcoholic fatty liver disease [J]. Chinese Journal of Hepatic Surgery(Electronic Edition), 2026, 15(02): 271-277.
[5]	Guangquan Zhang, Shengjie Hong, Xianyu Chen, Jicai Wang, Hang Zhai, Fenfang Wu, Xianjie Shi. Bioinformatics analysis of the role of endoplasmic reticulum stress-associated genes in the pathogenesis of nonalcoholic steatohepatitis [J]. Chinese Journal of Hepatic Surgery(Electronic Edition), 2025, 14(05): 761-769.
[6]	Kunxiao Zhao, Xiaoming Liu, Jie Feng, Xiuhong Hu, Wenting Zhao, Qiongzhen Lin. Activation of nuclear factor-E2-related factor 2 signaling pathway inhibited high glucose-induced epithelial-mesenchymal transition in human renal tubular epithelial cells [J]. Chinese Journal of Kidney Disease Investigation(Electronic Edition), 2026, 15(01): 15-20.
[7]	Shumei Tan, Yujie Cen, Siwen Ding, Honghao Liu, Jinwen Wei, Ziyuan Liu, Xuemin Li. Clinical characteristics and differences in aqueous humor antioxidant stress enzymes among age-related cataract patients in regions with different ultraviolet radiation levels [J]. Chinese Journal of Ophthalmologic Medicine(Electronic Edition), 2025, 15(06): 345-350.
[8]	Jun Li, Shulin Shen, Rongwei Zhang, Zhangrui Huang, Ruiming Liang, Shixing Luo. Protective Effect of Quercetin against H₂O₂-Induced Oxidative Damage in Osteoarthritic Chondrocytes [J]. Chinese Journal of Geriatric Orthopaedics and Rehabilitation(Electronic Edition), 2026, 12(02): 85-92.
[9]	Guanqi Li, Jiajun Tang, Jieling Liu, Fangmin Wang, Zhiyu Ding, Yi Peng, Weiguo Wang, Jinglei Miao, Shijie Chen, Jinsong Li. Identification of potential therapeutic targets for diffuse idiopathic skeletal hyperostosis via protein quantitative trait locus analysis [J]. Chinese Journal of Geriatric Orthopaedics and Rehabilitation(Electronic Edition), 2025, 11(06): 345-350.
[10]	Shuang Wu, Feng Yu, Haiqiang Pan, Tianyun Gong, Chenghao Chen. Effect of Lianyang Decoction enema on intestinal mucosal healing in ulcerative colitis based on TCM syndrome score and IL-37b/NF-κB axis [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2026, 16(02): 130-136.
[11]	Longjun He, Anmin He, Li Yao, Shuangshuang Yang. Therapeutic effect of Huangqi Jianzhong decoction combined with mesalazine enteric-coated tablets and bifidobacterium triplex live bacteria enteric-coated capsules on patients with ulcerative colitis and its impact on intestinal mucosal barrier function [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2026, 16(02): 146-150.
[12]	Chenran Wang, Xueliang Jiang. Comparison of the efficacy and safety of infliximab biosimilars and the original drug in the treatment of ulcerative colitis: Real-world cohort analysis [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2026, 16(01): 26-30.
[13]	Shuqin Shi, Guofa Jia, Xiquan Ke. Clinical efficacy of combination therapy of phenethylamine and rabeprazole in the treatment of ulcerative upper gastrointestinal bleeding and its impact on patients' oxidative stress response [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2026, 16(01): 31-35.
[14]	Fang Miao, Xiaohui Li, Shan Jiang. Protective mechanism of dimethyl fumarate against oxidative stress-induced melanocyte injury [J]. Chinese Journal of Clinicians(Electronic Edition), 2025, 19(07): 513-519.
[15]	Boni Li, Juanjuan Wei, Fanfan Zhang. Diagnostic value of IL-6 and C1q in acute ulcerative colitis and their correlation with gut microbiota [J]. Chinese Journal of Hygiene Rescue(Electronic Edition), 2025, 11(05): 269-273.

Please choose a citation manager

Content to export